https://socictopen.socict.org/files/original/3d4bfe033ba91dc7d10e76caef99e674.pdf d980bc9f26fb7e0dbb46eb56831877a5 Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Coronavirus Description An account of the resource Dominio científico: Coronavirus Text A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text. Dublin Core The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/. Title A name given to the resource Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus Creator An entity primarily responsible for making the resource Chang Liu, Ze Chen, Yue Hu, Haishuo Ji, Deshui Yu, Wenyuan Shen, Si-Yu Li, Jishou Ruan, Wenjun Bu, Shan Gao Description An account of the resource In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes. Date A point or period of time associated with an event in the lifecycle of the resource 2018 Subject The topic of the resource palindromic small RNA, complemented palindromic small RNA, small RNA, DNA complemented palindrome, severe acute respiratory syndrome coronavirus Identifier An unambiguous reference to the resource within a given context DOI: 10.3390/genes9090442 Source A related resource from which the described resource is derived Genes Publisher An entity responsible for making the resource available MDPI AG Coverage The spatial or temporal topic of the resource, the spatial applicability of the resource, or the jurisdiction under which the resource is relevant Genetics Language A language of the resource EN